three plasmid system Search Results


chr2 yfpnavii iii  (Addgene inc)
92
Addgene inc chr2 yfpnavii iii
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
Chr2 Yfpnavii Iii, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chr2 yfpnavii iii/product/Addgene inc
Average 92 stars, based on 1 article reviews
chr2 yfpnavii iii - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier
untagged parkin  (Addgene inc)
93
Addgene inc untagged parkin
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
Untagged Parkin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/untagged parkin/product/Addgene inc
Average 93 stars, based on 1 article reviews
untagged parkin - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
plasmid cmvt n ha he6ap  (Addgene inc)
93
Addgene inc plasmid cmvt n ha he6ap
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
Plasmid Cmvt N Ha He6ap, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid cmvt n ha he6ap/product/Addgene inc
Average 93 stars, based on 1 article reviews
plasmid cmvt n ha he6ap - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
human dusp10 mkp5  (Addgene inc)
90
Addgene inc human dusp10 mkp5
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
Human Dusp10 Mkp5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human dusp10 mkp5/product/Addgene inc
Average 90 stars, based on 1 article reviews
human dusp10 mkp5 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
c terminus  (Addgene inc)
92
Addgene inc c terminus
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
C Terminus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c terminus/product/Addgene inc
Average 92 stars, based on 1 article reviews
c terminus - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier
pl synapsin yfp navii iii construct  (Addgene inc)
92
Addgene inc pl synapsin yfp navii iii construct
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
Pl Synapsin Yfp Navii Iii Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pl synapsin yfp navii iii construct/product/Addgene inc
Average 92 stars, based on 1 article reviews
pl synapsin yfp navii iii construct - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier
aaac 3 overhang  (Addgene inc)
93
Addgene inc aaac 3 overhang
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
Aaac 3 Overhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aaac 3 overhang/product/Addgene inc
Average 93 stars, based on 1 article reviews
aaac 3 overhang - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
agtc gtcgac s 4 ttatttagctttgttctcggcaatcttcttgcgaaattc  (Addgene inc)
86
Addgene inc agtc gtcgac s 4 ttatttagctttgttctcggcaatcttcttgcgaaattc
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
Agtc Gtcgac S 4 Ttatttagctttgttctcggcaatcttcttgcgaaattc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/agtc gtcgac s 4 ttatttagctttgttctcggcaatcttcttgcgaaattc/product/Addgene inc
Average 86 stars, based on 1 article reviews
agtc gtcgac s 4 ttatttagctttgttctcggcaatcttcttgcgaaattc - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier
c µ2  (Addgene inc)
85
Addgene inc c µ2
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
C µ2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c µ2/product/Addgene inc
Average 85 stars, based on 1 article reviews
c µ2 - by Bioz Stars, 2026-03
85/100 stars
  Buy from Supplier
caaa overhang  (Addgene inc)
91
Addgene inc caaa overhang
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
Caaa Overhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caaa overhang/product/Addgene inc
Average 91 stars, based on 1 article reviews
caaa overhang - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier
pentr tht iii  (Addgene inc)
91
Addgene inc pentr tht iii
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
Pentr Tht Iii, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pentr tht iii/product/Addgene inc
Average 91 stars, based on 1 article reviews
pentr tht iii - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier
293t cells  (Addgene inc)
91
Addgene inc 293t cells
Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or <t>ChR2(H134R).</t> Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.
293t Cells, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/293t cells/product/Addgene inc
Average 91 stars, based on 1 article reviews
293t cells - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

Image Search Results


Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or ChR2(H134R). Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.

Journal: Science advances

Article Title: Optogenetic calcium modulation in astrocytes enhances post-stroke recovery in chronic capsular infarct.

doi: 10.1126/sciadv.adn7577

Figure Lengend Snippet: Fig. 1. Light-induced Ca2+ influx in astrocytes through OptoSTIM1 activation. (A) Fluorescence images of cultured astrocytes expressing RGECO1 along with OptoSTIM1 or ChR2(H134R). Scale bars, 20 μm. (B) Kymographs corresponding to the white dotted lines in (A), showing RGECO1 fluorescence upon light stimulation. (C) A graph illustrating changes in RGECO1 intensity upon light stimulation or NE (5 μM) treatment. (D) Graphs showing the time required to reach half-maximal intensity (left, Ta1/2, “a” refers to activation) and half-basal intensity from the maximal intensity of RGECO1 fluorescence (right, Td1/2, where “d” refers to deactivation) upon OptoSTIM1 activa- tion. (E) Schematic diagram and experimental timeline of the virus injection and two-photon Ca2+ imaging. Representative two-photon images of a brain slice demon- strate the viral expression of Lenti-GfaABC1D-OptoSTIM1 (green) and AAV-GfaABC1D-jRGECO1a (red) in the SPC. Scale bar, 100 μm. (F) Representative Ca2+ traces of RGECO1 intensity upon light stimulation. (G) A graph illustrating changes in the average fluorescent ratio for the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups. The purple-shaded area indicates the period of light stimulation. (H) Comparison of peak Ca2+ signals in the GfaABC1D-EGFP and GfaABC1D-OptoSTIM1 groups before and after light stimulation [repeated-measures two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons, F1,24 = 130.6, P < 0.0001]. Error bars represent means ± SEM. ***P < 0.001; ns, nonsignificant.

Article Snippet: For construction of expression plasmid for ChR2(H134R)- mEGFP, the ChR2(H134R) sequence from ChR2- YFPNavII- III (Addgene plasmid #26057) was amplified by polymerase chain reaction (PCR) using ChR2(H134R)- F (5′-GACTGCTAGCGCCACCATGGACTATGGCGG-3′) and ChR2(H134R)- R (5’-GACTACCGGTGCTGGCACGGCTCCGGC-3′) primers.

Techniques: Activation Assay, Fluorescence, Cell Culture, Expressing, Virus, Injection, Imaging, Slice Preparation, Comparison